Browsing Mutation Sites on Lineage BE.1.1.1


Overview of the global distribution of genome sequences on lineage BE.1.1.1.
Note: Color representation of genome sequence counts.



The temporal dynamics of genome sequence count within lineage BE.1.1.1.
Note: Clicking the "Count" or "Cumulative Count" button toggles the view. Count represents the number of genome sequences per month. Cumulative count represents the accumulated total count up to that month.




Mutation table of lineage BE.1.1.1.
Note: Click on the mutation ID in the table to retrieve the complete annotation information for that mutation.

Mutation ID Lineage name Mutation frequency Gene ID Gene name Genome position DNA mutation Mutation type Protein mutation-1 letter Protein mutation-3 letter
V2576 BE.1.1.1 7.57e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 14257 13993T>C missense_variant Y4665H Tyr4665His
V2595 BE.1.1.1 9.73e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 14408 14144C>T missense_variant P4715L Pro4715Leu
V2711 BE.1.1.1 3.11e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15656 15392C>T missense_variant T5131I Thr5131Ile
V2839 BE.1.1.1 9.14e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 16935 16671G>A missense_variant M5557I Met5557Ile
V2860 BE.1.1.1 1.27e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 17039 16775A>G missense_variant N5592S Asn5592Ser
V2918 BE.1.1.1 9.91e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 17410 17146C>T missense_variant R5716C Arg5716Cys
V3015 BE.1.1.1 9.63e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 18163 17899A>G missense_variant I5967V Ile5967Val
V1982 BE.1.1.1 9.90e-1 GU280_gp01_pp1a ORF1ab_pp1a 10029 9764C>T missense_variant T3255I Thr3255Ile
V569 BE.1.1.1 9.43e-1 GU280_gp01_pp1a ORF1ab_pp1a 1931 1666C>A missense_variant Q556K Gln556Lys
V580 BE.1.1.1 4.95e-2 GU280_gp01_pp1a ORF1ab_pp1a 1959 1694C>T missense_variant A565V Ala565Val
V3273 BE.1.1.1 9.03e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 19955 19691C>T missense_variant T6564I Thr6564Ile
V2116 BE.1.1.1 9.13e-2 GU280_gp01_pp1a ORF1ab_pp1a 11083 10818G>T missense_variant L3606F Leu3606Phe
V3495 BE.1.1.1 1.45e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 21372 21108G>T missense_variant Q7036H Gln7036His
V3520 BE.1.1.1 1.95e-2 GU280_gp02 S 21575 13C>T missense_variant L5F Leu5Phe
V3534 BE.1.1.1 9.29e-1 GU280_gp02 S 21618 56C>T missense_variant T19I Thr19Ile
V3544 BE.1.1.1 8.81e-1 GU280_gp02 S 21632 71_79delTACCCCCTG disruptive_inframe_deletion L24_A27delinsS Leu24_Ala27delinsSer
V3547 BE.1.1.1 4.95e-2 GU280_gp02 S 21633 71T>C missense_variant L24S Leu24Ser
V3555 BE.1.1.1 2.87e-2 GU280_gp02 S 21641 79G>T missense_variant A27S Ala27Ser
V3578 BE.1.1.1 8.64e-1 GU280_gp02 S 21764 204_209delACATGT disruptive_inframe_deletion H69_V70del His69_Val70del
V3579 BE.1.1.1 1.20e-2 GU280_gp02 S 21765 204_208delACATG frameshift_variant H69fs His69fs
V3583 BE.1.1.1 6.23e-2 GU280_gp02 S 21770 208G>A missense_variant V70I Val70Ile
V3614 BE.1.1.1 1.03e-2 GU280_gp02 S 21853 291G>T missense_variant K97N Lys97Asn
V3635 BE.1.1.1 9.76e-1 GU280_gp02 S 21987 425G>A missense_variant G142D Gly142Asp
V3638 BE.1.1.1 9.23e-2 GU280_gp02 S 21990 432_434delTTA disruptive_inframe_deletion Y145del Tyr145del
V3735 BE.1.1.1 9.86e-1 GU280_gp02 S 22200 638T>G missense_variant V213G Val213Gly
V2163 BE.1.1.1 9.60e-1 GU280_gp01_pp1a ORF1ab_pp1a 11287 11023_11031delTCTGGTTTT conservative_inframe_deletion S3675_F3677del Ser3675_Phe3677del
V2165 BE.1.1.1 5.34e-2 GU280_gp01_pp1a ORF1ab_pp1a 11288 11023T>A missense_variant S3675T Ser3675Thr
V2167 BE.1.1.1 9.27e-2 GU280_gp01_pp1a ORF1ab_pp1a 11291 11026G>A missense_variant G3676S Gly3676Ser
V2169 BE.1.1.1 2.29e-1 GU280_gp01_pp1a ORF1ab_pp1a 11296 11031T>G missense_variant F3677L Phe3677Leu
V3807 BE.1.1.1 2.02e-2 GU280_gp02 S 22458 896C>T missense_variant T299I Thr299Ile
V3820 BE.1.1.1 8.81e-1 GU280_gp02 S 22578 1016G>A missense_variant G339D Gly339Asp
V3824 BE.1.1.1 1.74e-1 GU280_gp02 S 22599 1037G>C missense_variant R346T Arg346Thr
V3840 BE.1.1.1 8.98e-1 GU280_gp02 S 22674 1112C>T missense_variant S371F Ser371Phe
V3841 BE.1.1.1 9.05e-1 GU280_gp02 S 22679 1117T>C missense_variant S373P Ser373Pro
V3843 BE.1.1.1 9.02e-1 GU280_gp02 S 22686 1124C>T missense_variant S375F Ser375Phe
V3844 BE.1.1.1 9.02e-1 GU280_gp02 S 22688 1126A>G missense_variant T376A Thr376Ala
V3851 BE.1.1.1 8.90e-1 GU280_gp02 S 22775 1213G>A missense_variant D405N Asp405Asn
V3854 BE.1.1.1 8.61e-1 GU280_gp02 S 22786 1224A>C missense_variant R408S Arg408Ser
V3861 BE.1.1.1 8.52e-1 GU280_gp02 S 22813 1251G>T missense_variant K417N Lys417Asn
V3862 BE.1.1.1 1.73e-2 GU280_gp02 S 22820 1258G>A missense_variant D420N Asp420Asn
V3868 BE.1.1.1 8.79e-1 GU280_gp02 S 22882 1320T>G missense_variant N440K Asn440Lys
V3869 BE.1.1.1 8.83e-1 GU280_gp02 S 22893 1331A>C missense_variant K444T Lys444Thr
V3886 BE.1.1.1 8.68e-1 GU280_gp02 S 22917 1355T>G missense_variant L452R Leu452Arg
V3890 BE.1.1.1 1.66e-1 GU280_gp02 S 22942 1380T>A missense_variant N460K Asn460Lys
V3896 BE.1.1.1 8.50e-1 GU280_gp02 S 22992 1430G>A missense_variant S477N Ser477Asn
V3900 BE.1.1.1 8.74e-1 GU280_gp02 S 22995 1433C>A missense_variant T478K Thr478Lys
V3911 BE.1.1.1 9.05e-1 GU280_gp02 S 23013 1451A>C missense_variant E484A Glu484Ala
V3916 BE.1.1.1 9.01e-1 GU280_gp02 S 23018 1456T>G missense_variant F486V Phe486Val
V3926 BE.1.1.1 9.20e-1 GU280_gp02 S 23055 1493A>G missense_variant Q498R Gln498Arg
V3927 BE.1.1.1 9.23e-1 GU280_gp02 S 23063 1501A>T missense_variant N501Y Asn501Tyr
V3930 BE.1.1.1 9.25e-1 GU280_gp02 S 23075 1513T>C missense_variant Y505H Tyr505His
V3969 BE.1.1.1 9.61e-1 GU280_gp02 S 23403 1841A>G missense_variant D614G Asp614Gly
V3988 BE.1.1.1 1.45e-2 GU280_gp02 S 23487 1925T>G missense_variant V642G Val642Gly
V3997 BE.1.1.1 9.94e-1 GU280_gp02 S 23525 1963C>T missense_variant H655Y His655Tyr
V4019 BE.1.1.1 9.53e-1 GU280_gp02 S 23599 2037T>G missense_variant N679K Asn679Lys
V4022 BE.1.1.1 9.73e-1 GU280_gp02 S 23604 2042C>A missense_variant P681H Pro681His
V4047 BE.1.1.1 1.03e-2 GU280_gp02 S 23679 2117C>T missense_variant A706V Ala706Val
V4063 BE.1.1.1 9.79e-1 GU280_gp02 S 23854 2292C>A missense_variant N764K Asn764Lys
V4079 BE.1.1.1 9.69e-1 GU280_gp02 S 23948 2386G>T missense_variant D796Y Asp796Tyr
V97 BE.1.1.1 7.91e-1 GU280_gp01_pp1a ORF1ab_pp1a 241 -25C>T upstream_gene_variant None None
V4126 BE.1.1.1 1.20e-2 GU280_gp02 S 24356 2794G>A missense_variant G932S Gly932Ser
V4144 BE.1.1.1 9.93e-1 GU280_gp02 S 24424 2862A>T missense_variant Q954H Gln954His
V4146 BE.1.1.1 9.78e-1 GU280_gp02 S 24469 2907T>A missense_variant N969K Asn969Lys
V4483 BE.1.1.1 1.10e-2 GU280_gp03 ORF3a 25714 322C>T missense_variant L108F Leu108Phe
V2241 BE.1.1.1 9.49e-1 GU280_gp01_pp1a ORF1ab_pp1a 11750 11485C>T missense_variant L3829F Leu3829Phe
V4596 BE.1.1.1 9.90e-1 GU280_gp03 ORF3a 26060 668C>T missense_variant T223I Thr223Ile
V4663 BE.1.1.1 9.55e-1 GU280_gp04 E 26270 26C>T missense_variant T9I Thr9Ile
V4718 BE.1.1.1 9.20e-1 GU280_gp05 M 26529 7G>A missense_variant D3N Asp3Asn
V4729 BE.1.1.1 9.41e-1 GU280_gp05 M 26577 55C>G missense_variant Q19E Gln19Glu
V4742 BE.1.1.1 9.71e-1 GU280_gp05 M 26709 187G>A missense_variant A63T Ala63Thr
V5060 BE.1.1.1 8.81e-1 GU280_gp09 ORF8 27889 -5C>T upstream_gene_variant None None
V773 BE.1.1.1 9.54e-1 GU280_gp01_pp1a ORF1ab_pp1a 2790 2525C>T missense_variant T842I Thr842Ile
V5070 BE.1.1.1 4.39e-2 GU280_gp09 ORF8 27910 17T>C missense_variant F6S Phe6Ser
V5241 BE.1.1.1 9.45e-1 GU280_gp10 N 28271 -3A>T upstream_gene_variant None None
V5274 BE.1.1.1 9.78e-1 GU280_gp10 N 28311 38C>T missense_variant P13L Pro13Leu
V5305 BE.1.1.1 9.49e-1 GU280_gp10 N 28361 90_98delAGAACGCAG disruptive_inframe_deletion E31_S33del Glu31_Ser33del
V5313 BE.1.1.1 3.36e-2 GU280_gp10 N 28370 97A>G missense_variant S33G Ser33Gly
V784 BE.1.1.1 1.95e-2 GU280_gp01_pp1a ORF1ab_pp1a 2867 2602G>T missense_variant V868L Val868Leu
V5383 BE.1.1.1 9.64e-1 GU280_gp10 N 28681 408G>T missense_variant E136D Glu136Asp
V5461 BE.1.1.1 9.81e-1 GU280_gp10 N 28881 608G>A missense_variant R203K Arg203Lys
V5465 BE.1.1.1 9.82e-1 GU280_gp10 N 28883 610G>C missense_variant G204R Gly204Arg
V5521 BE.1.1.1 1.41e-2 GU280_gp10 N 28986 713G>T missense_variant G238V Gly238Val
V5651 BE.1.1.1 9.22e-1 GU280_gp10 N 29510 1237A>C missense_variant S413R Ser413Arg
V5663 BE.1.1.1 2.33e-2 GU280_gp11 ORF10 29541 -17C>T upstream_gene_variant None None
V5758 BE.1.1.1 1.09e-1 GU280_gp02 S 29733 *4350_*4375delGAGGCCACGCGGAGTACGATCGAGTG downstream_gene_variant None None
V5762 BE.1.1.1 1.70e-2 GU280_gp02 S 29734 *4350G>T downstream_gene_variant None None
V5834 BE.1.1.1 1.24e-2 GU280_gp02 S 29868 *4484G>A downstream_gene_variant None None
V1114 BE.1.1.1 9.88e-1 GU280_gp01_pp1a ORF1ab_pp1a 4184 3919G>A missense_variant G1307S Gly1307Ser
V6 BE.1.1.1 7.15e-2 GU280_gp01_pp1a ORF1ab_pp1a 44 -222C>T upstream_gene_variant None None
V1172 BE.1.1.1 1.34e-2 GU280_gp01_pp1a ORF1ab_pp1a 4752 4487C>T missense_variant T1496I Thr1496Ile
V181 BE.1.1.1 2.76e-2 GU280_gp01_pp1a ORF1ab_pp1a 507 245_259delGTCATGTTATGGTTG disruptive_inframe_deletion G82_V86del Gly82_Val86del
V192 BE.1.1.1 1.95e-2 GU280_gp01_pp1a ORF1ab_pp1a 514 253_258delATGGTT conservative_inframe_deletion M85_V86del Met85_Val86del
V1307 BE.1.1.1 1.31e-2 GU280_gp01_pp1a ORF1ab_pp1a 5555 5290G>A missense_variant G1764S Gly1764Ser
V232 BE.1.1.1 1.66e-2 GU280_gp01_pp1a ORF1ab_pp1a 611 346G>A missense_variant V116M Val116Met
V249 BE.1.1.1 9.85e-1 GU280_gp01_pp1a ORF1ab_pp1a 670 405T>G missense_variant S135R Ser135Arg
V260 BE.1.1.1 1.06e-2 GU280_gp01_pp1a ORF1ab_pp1a 685 421_429delAAGTCATTT conservative_inframe_deletion K141_F143del Lys141_Phe143del
V268 BE.1.1.1 1.24e-2 GU280_gp01_pp1a ORF1ab_pp1a 704 439G>A missense_variant D147N Asp147Asn
V1907 BE.1.1.1 9.76e-1 GU280_gp01_pp1a ORF1ab_pp1a 9344 9079C>T missense_variant L3027F Leu3027Phe
V1937 BE.1.1.1 9.42e-1 GU280_gp01_pp1a ORF1ab_pp1a 9534 9269C>T missense_variant T3090I Thr3090Ile
V2037 BE.1.1.1 9.86e-1 GU280_gp01_pp1a ORF1ab_pp1a 10449 10184C>A missense_variant P3395H Pro3395His
V6254 BE.1.1.1 9.36e-1 GU280_gp01_pp1a ORF1ab_pp1a 2954 2689T>C synonymous_variant L897L Leu897Leu
V6265 BE.1.1.1 9.82e-1 GU280_gp01_pp1a ORF1ab_pp1a 3037 2772C>T synonymous_variant F924F Phe924Phe
V6426 BE.1.1.1 9.23e-1 GU280_gp01_pp1a ORF1ab_pp1a 4321 4056C>T synonymous_variant A1352A Ala1352Ala
V7082 BE.1.1.1 9.40e-1 GU280_gp01_pp1a ORF1ab_pp1a 9424 9159A>G synonymous_variant V3053V Val3053Val
V7193 BE.1.1.1 9.21e-1 GU280_gp01_pp1a ORF1ab_pp1a 10198 9933C>T synonymous_variant D3311D Asp3311Asp
V7219 BE.1.1.1 9.86e-1 GU280_gp01_pp1a ORF1ab_pp1a 10447 10182G>A synonymous_variant R3394R Arg3394Arg
V7437 BE.1.1.1 9.81e-1 GU280_gp01_pp1a ORF1ab_pp1a 12160 11895G>A synonymous_variant E3965E Glu3965Glu
V7520 BE.1.1.1 9.61e-1 GU280_gp01_pp1a ORF1ab_pp1a 12880 12615C>T synonymous_variant I4205I Ile4205Ile
V7830 BE.1.1.1 2.37e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15240 14976C>T synonymous_variant N4992N Asn4992Asn
V7888 BE.1.1.1 9.89e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 15714 15450C>T synonymous_variant L5150L Leu5150Leu
V8132 BE.1.1.1 2.33e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 17550 17286C>T synonymous_variant L5762L Leu5762Leu
V8457 BE.1.1.1 9.47e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 20055 19791A>G synonymous_variant E6597E Glu6597Glu
V9076 BE.1.1.1 9.70e-1 GU280_gp02 S 25000 3438C>T synonymous_variant D1146D Asp1146Asp
V9171 BE.1.1.1 9.79e-1 GU280_gp03 ORF3a 25584 192C>T synonymous_variant T64T Thr64Thr
V9496 BE.1.1.1 9.59e-1 GU280_gp08 ORF7b 27807 52C>T synonymous_variant L18L Leu18Leu
V9564 BE.1.1.1 9.75e-1 GU280_gp10 N 28312 39C>T synonymous_variant P13P Pro13Pro
V9682 BE.1.1.1 9.81e-1 GU280_gp10 N 28882 609G>A synonymous_variant R203R Arg203Arg
V6288 BE.1.1.1 9.34e-2 GU280_gp01_pp1a ORF1ab_pp1a 3241 2976C>T synonymous_variant D992D Asp992Asp
V8407 BE.1.1.1 1.27e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 19602 19338C>T synonymous_variant N6446N Asn6446Asn
V5841 BE.1.1.1 1.97e-1 GU280_gp01_pp1a ORF1ab_pp1a 313 48C>T synonymous_variant L16L Leu16Leu
V6940 BE.1.1.1 1.70e-2 GU280_gp01_pp1a ORF1ab_pp1a 8293 8028C>T synonymous_variant T2676T Thr2676Thr
V9576 BE.1.1.1 5.66e-2 GU280_gp10 N 28363 90A>T synonymous_variant G30G Gly30Gly
V7720 BE.1.1.1 3.40e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 14424 14160A>C synonymous_variant P4720P Pro4720Pro
V9586 BE.1.1.1 1.80e-2 GU280_gp10 N 28390 117A>G synonymous_variant Q39Q Gln39Gln
V9677 BE.1.1.1 2.26e-2 GU280_gp10 N 28849 576C>T synonymous_variant N192N Asn192Asn
V8650 BE.1.1.1 2.09e-2 GU280_gp02 S 21766 204A>C synonymous_variant I68I Ile68Ile
V5843 BE.1.1.1 1.04e-1 GU280_gp01_pp1a ORF1ab_pp1a 337 72C>T synonymous_variant R24R Arg24Arg
V6638 BE.1.1.1 2.02e-2 GU280_gp01_pp1a ORF1ab_pp1a 5884 5619C>T synonymous_variant Y1873Y Tyr1873Tyr
V8071 BE.1.1.1 2.19e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 17130 16866C>T synonymous_variant Y5622Y Tyr5622Tyr
V6869 BE.1.1.1 5.02e-2 GU280_gp01_pp1a ORF1ab_pp1a 7765 7500C>T synonymous_variant S2500S Ser2500Ser
V7168 BE.1.1.1 1.49e-2 GU280_gp01_pp1a ORF1ab_pp1a 10030 9765C>T synonymous_variant T3255T Thr3255Thr
V7457 BE.1.1.1 1.41e-2 GU280_gp01_pp1a ORF1ab_pp1a 12322 12057G>A synonymous_variant E4019E Glu4019Glu
V5966 BE.1.1.1 1.19e-1 GU280_gp01_pp1a ORF1ab_pp1a 958 693C>T synonymous_variant C231C Cys231Cys
V7093 BE.1.1.1 7.78e-2 GU280_gp01_pp1a ORF1ab_pp1a 9487 9222C>T synonymous_variant Y3074Y Tyr3074Tyr
V7030 BE.1.1.1 1.84e-2 GU280_gp01_pp1a ORF1ab_pp1a 9037 8772T>C synonymous_variant D2924D Asp2924Asp
V9813 BE.1.1.1 1.91e-2 GU280_gp10 N 29518 1245C>T synonymous_variant D415D Asp415Asp
V8899 BE.1.1.1 1.45e-2 GU280_gp02 S 23608 2046G>T synonymous_variant R682R Arg682Arg
V6367 BE.1.1.1 1.27e-2 GU280_gp01_pp1a ORF1ab_pp1a 3817 3552C>T synonymous_variant D1184D Asp1184Asp
V6338 BE.1.1.1 1.70e-2 GU280_gp01_pp1a ORF1ab_pp1a 3583 3318C>T synonymous_variant S1106S Ser1106Ser
V7882 BE.1.1.1 3.29e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15657 15393A>G synonymous_variant T5131T Thr5131Thr
V8699 BE.1.1.1 1.13e-2 GU280_gp02 S 22075 513C>T synonymous_variant V171V Val171Val
V7542 BE.1.1.1 1.13e-2 GU280_gp01_pp1a ORF1ab_pp1a 13057 12792A>T synonymous_variant S4264S Ser4264Ser