Browsing Mutation Sites on Lineage BN.1.1.1


Overview of the global distribution of genome sequences on lineage BN.1.1.1.
Note: Color representation of genome sequence counts.



The temporal dynamics of genome sequence count within lineage BN.1.1.1.
Note: Clicking the "Count" or "Cumulative Count" button toggles the view. Count represents the number of genome sequences per month. Cumulative count represents the accumulated total count up to that month.




Mutation table of lineage BN.1.1.1.
Note: Click on the mutation ID in the table to retrieve the complete annotation information for that mutation.

Mutation ID Lineage name Mutation frequency Gene ID Gene name Genome position DNA mutation Mutation type Protein mutation-1 letter Protein mutation-3 letter
V2595 BN.1.1.1 1.00e+0 GU280_gp01_pp1ab ORF1ab_pp1ab 14408 14144C>T missense_variant P4715L Pro4715Leu
V2694 BN.1.1.1 9.98e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 15451 15187G>A missense_variant G5063S Gly5063Ser
V2791 BN.1.1.1 2.89e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 16474 16210A>G missense_variant S5404G Ser5404Gly
V2864 BN.1.1.1 1.20e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 17058 16794G>A missense_variant M5598I Met5598Ile
V2918 BN.1.1.1 9.98e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 17410 17146C>T missense_variant R5716C Arg5716Cys
V48 BN.1.1.1 2.06e-2 GU280_gp01_pp1a ORF1ab_pp1a 174 -92G>T upstream_gene_variant None None
V3015 BN.1.1.1 9.94e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 18163 17899A>G missense_variant I5967V Ile5967Val
V3125 BN.1.1.1 2.89e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 18844 18580G>A missense_variant V6194I Val6194Ile
V1982 BN.1.1.1 9.94e-1 GU280_gp01_pp1a ORF1ab_pp1a 10029 9764C>T missense_variant T3255I Thr3255Ile
V3233 BN.1.1.1 1.03e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 19655 19391A>G missense_variant K6464R Lys6464Arg
V3273 BN.1.1.1 8.06e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 19955 19691C>T missense_variant T6564I Thr6564Ile
V3350 BN.1.1.1 3.51e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 20404 20140C>T missense_variant P6714S Pro6714Ser
V3394 BN.1.1.1 3.71e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 20623 20359G>T missense_variant D6787Y Asp6787Tyr
V3413 BN.1.1.1 4.12e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 20762 20498C>T missense_variant T6833I Thr6833Ile
V3454 BN.1.1.1 1.86e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 21137 20873A>G missense_variant K6958R Lys6958Arg
V629 BN.1.1.1 1.03e-2 GU280_gp01_pp1a ORF1ab_pp1a 2144 1879G>A missense_variant V627I Val627Ile
V3512 BN.1.1.1 1.24e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 21523 21259G>A missense_variant V7087I Val7087Ile
V3534 BN.1.1.1 9.61e-1 GU280_gp02 S 21618 56C>T missense_variant T19I Thr19Ile
V3539 BN.1.1.1 1.44e-2 GU280_gp02 S 21624 62G>C missense_variant R21T Arg21Thr
V3544 BN.1.1.1 9.20e-1 GU280_gp02 S 21632 71_79delTACCCCCTG disruptive_inframe_deletion L24_A27delinsS Leu24_Ala27delinsSer
V3547 BN.1.1.1 3.30e-2 GU280_gp02 S 21633 71T>C missense_variant L24S Leu24Ser
V3555 BN.1.1.1 4.54e-2 GU280_gp02 S 21641 79G>T missense_variant A27S Ala27Ser
V3635 BN.1.1.1 9.55e-1 GU280_gp02 S 21987 425G>A missense_variant G142D Gly142Asp
V3646 BN.1.1.1 1.24e-2 GU280_gp02 S 21995 433T>C missense_variant Y145H Tyr145His
V3652 BN.1.1.1 9.48e-1 GU280_gp02 S 22001 439A>G missense_variant K147E Lys147Glu
V3662 BN.1.1.1 9.40e-1 GU280_gp02 S 22016 454T>C missense_variant W152R Trp152Arg
V3675 BN.1.1.1 9.44e-1 GU280_gp02 S 22033 471C>A missense_variant F157L Phe157Leu
V3708 BN.1.1.1 9.38e-1 GU280_gp02 S 22115 553A>G missense_variant N185D Asn185Asp
V3724 BN.1.1.1 9.59e-1 GU280_gp02 S 22190 628A>G missense_variant I210V Ile210Val
V3735 BN.1.1.1 9.61e-1 GU280_gp02 S 22200 638T>G missense_variant V213G Val213Gly
V2163 BN.1.1.1 9.92e-1 GU280_gp01_pp1a ORF1ab_pp1a 11287 11023_11031delTCTGGTTTT conservative_inframe_deletion S3675_F3677del Ser3675_Phe3677del
V2165 BN.1.1.1 2.27e-2 GU280_gp01_pp1a ORF1ab_pp1a 11288 11023T>A missense_variant S3675T Ser3675Thr
V2167 BN.1.1.1 7.01e-2 GU280_gp01_pp1a ORF1ab_pp1a 11291 11026G>A missense_variant G3676S Gly3676Ser
V3784 BN.1.1.1 9.40e-1 GU280_gp02 S 22331 769G>A missense_variant G257S Gly257Ser
V2169 BN.1.1.1 2.10e-1 GU280_gp01_pp1a ORF1ab_pp1a 11296 11031T>G missense_variant F3677L Phe3677Leu
V3818 BN.1.1.1 9.36e-1 GU280_gp02 S 22577 1015G>C missense_variant G339R Gly339Arg
V3820 BN.1.1.1 9.48e-1 GU280_gp02 S 22578 1016G>A missense_variant G339D Gly339Asp
V3824 BN.1.1.1 9.46e-1 GU280_gp02 S 22599 1037G>C missense_variant R346T Arg346Thr
V3832 BN.1.1.1 9.55e-1 GU280_gp02 S 22629 1067A>C missense_variant K356T Lys356Thr
V3840 BN.1.1.1 9.51e-1 GU280_gp02 S 22674 1112C>T missense_variant S371F Ser371Phe
V3841 BN.1.1.1 9.51e-1 GU280_gp02 S 22679 1117T>C missense_variant S373P Ser373Pro
V3843 BN.1.1.1 9.44e-1 GU280_gp02 S 22686 1124C>T missense_variant S375F Ser375Phe
V3844 BN.1.1.1 9.46e-1 GU280_gp02 S 22688 1126A>G missense_variant T376A Thr376Ala
V3851 BN.1.1.1 9.46e-1 GU280_gp02 S 22775 1213G>A missense_variant D405N Asp405Asn
V3854 BN.1.1.1 8.95e-1 GU280_gp02 S 22786 1224A>C missense_variant R408S Arg408Ser
V3861 BN.1.1.1 9.40e-1 GU280_gp02 S 22813 1251G>T missense_variant K417N Lys417Asn
V3868 BN.1.1.1 9.53e-1 GU280_gp02 S 22882 1320T>G missense_variant N440K Asn440Lys
V3877 BN.1.1.1 9.57e-1 GU280_gp02 S 22898 1336G>A missense_variant G446S Gly446Ser
V3891 BN.1.1.1 9.71e-1 GU280_gp02 S 22942 1380T>G missense_variant N460K Asn460Lys
V3896 BN.1.1.1 9.75e-1 GU280_gp02 S 22992 1430G>A missense_variant S477N Ser477Asn
V3900 BN.1.1.1 9.77e-1 GU280_gp02 S 22995 1433C>A missense_variant T478K Thr478Lys
V3911 BN.1.1.1 9.77e-1 GU280_gp02 S 23013 1451A>C missense_variant E484A Glu484Ala
V3921 BN.1.1.1 9.77e-1 GU280_gp02 S 23031 1469T>C missense_variant F490S Phe490Ser
V3924 BN.1.1.1 9.65e-1 GU280_gp02 S 23042 1480T>C missense_variant S494P Ser494Pro
V3926 BN.1.1.1 9.77e-1 GU280_gp02 S 23055 1493A>G missense_variant Q498R Gln498Arg
V3927 BN.1.1.1 9.79e-1 GU280_gp02 S 23063 1501A>T missense_variant N501Y Asn501Tyr
V3930 BN.1.1.1 9.79e-1 GU280_gp02 S 23075 1513T>C missense_variant Y505H Tyr505His
V3969 BN.1.1.1 1.00e+0 GU280_gp02 S 23403 1841A>G missense_variant D614G Asp614Gly
V3997 BN.1.1.1 9.98e-1 GU280_gp02 S 23525 1963C>T missense_variant H655Y His655Tyr
V4019 BN.1.1.1 9.98e-1 GU280_gp02 S 23599 2037T>G missense_variant N679K Asn679Lys
V4022 BN.1.1.1 9.94e-1 GU280_gp02 S 23604 2042C>A missense_variant P681H Pro681His
V4063 BN.1.1.1 9.28e-1 GU280_gp02 S 23854 2292C>A missense_variant N764K Asn764Lys
V4079 BN.1.1.1 9.96e-1 GU280_gp02 S 23948 2386G>T missense_variant D796Y Asp796Tyr
V97 BN.1.1.1 8.10e-1 GU280_gp01_pp1a ORF1ab_pp1a 241 -25C>T upstream_gene_variant None None
V4144 BN.1.1.1 1.00e+0 GU280_gp02 S 24424 2862A>T missense_variant Q954H Gln954His
V4146 BN.1.1.1 9.98e-1 GU280_gp02 S 24469 2907T>A missense_variant N969K Asn969Lys
V2225 BN.1.1.1 1.03e-2 GU280_gp01_pp1a ORF1ab_pp1a 11577 11312T>C missense_variant I3771T Ile3771Thr
V4367 BN.1.1.1 3.51e-2 GU280_gp03 ORF3a 25513 121C>T missense_variant L41F Leu41Phe
V2241 BN.1.1.1 6.80e-2 GU280_gp01_pp1a ORF1ab_pp1a 11750 11485C>T missense_variant L3829F Leu3829Phe
V4596 BN.1.1.1 9.94e-1 GU280_gp03 ORF3a 26060 668C>T missense_variant T223I Thr223Ile
V4663 BN.1.1.1 9.98e-1 GU280_gp04 E 26270 26C>T missense_variant T9I Thr9Ile
V4664 BN.1.1.1 9.98e-1 GU280_gp04 E 26275 31A>G missense_variant T11A Thr11Ala
V377 BN.1.1.1 4.74e-2 GU280_gp01_pp1a ORF1ab_pp1a 1190 925C>T missense_variant P309S Pro309Ser
V4692 BN.1.1.1 1.03e-2 GU280_gp04 E 26456 212C>T missense_variant P71L Pro71Leu
V4729 BN.1.1.1 9.79e-1 GU280_gp05 M 26577 55C>G missense_variant Q19E Gln19Glu
V4742 BN.1.1.1 9.77e-1 GU280_gp05 M 26709 187G>A missense_variant A63T Ala63Thr
V4839 BN.1.1.1 9.84e-1 GU280_gp06 ORF6 27382 181G>C missense_variant D61H Asp61His
V4841 BN.1.1.1 9.84e-1 GU280_gp06 ORF6 27383 182A>T missense_variant D61V Asp61Val
V4933 BN.1.1.1 3.71e-2 GU280_gp07 ORF7a 27605 212T>C missense_variant V71A Val71Ala
V773 BN.1.1.1 9.67e-1 GU280_gp01_pp1a ORF1ab_pp1a 2790 2525C>T missense_variant T842I Thr842Ile
V5228 BN.1.1.1 3.51e-2 GU280_gp09 ORF8 28253 361delA frameshift_variant I121fs Ile121fs
V5241 BN.1.1.1 9.96e-1 GU280_gp10 N 28271 -3A>T upstream_gene_variant None None
V5274 BN.1.1.1 9.92e-1 GU280_gp10 N 28311 38C>T missense_variant P13L Pro13Leu
V5305 BN.1.1.1 9.69e-1 GU280_gp10 N 28361 90_98delAGAACGCAG disruptive_inframe_deletion E31_S33del Glu31_Ser33del
V5313 BN.1.1.1 2.06e-2 GU280_gp10 N 28370 97A>G missense_variant S33G Ser33Gly
V5316 BN.1.1.1 1.03e-2 GU280_gp10 N 28371 98G>T missense_variant S33I Ser33Ile
V5376 BN.1.1.1 1.03e-2 GU280_gp10 N 28651 378C>A missense_variant N126K Asn126Lys
V2326 BN.1.1.1 9.98e-1 GU280_gp01_pp1a ORF1ab_pp1a 12444 12179A>G missense_variant N4060S Asn4060Ser
V5461 BN.1.1.1 9.81e-1 GU280_gp10 N 28881 608G>A missense_variant R203K Arg203Lys
V5465 BN.1.1.1 9.81e-1 GU280_gp10 N 28883 610G>C missense_variant G204R Gly204Arg
V5586 BN.1.1.1 3.51e-2 GU280_gp10 N 29304 1031C>T missense_variant P344L Pro344Leu
V5600 BN.1.1.1 1.86e-2 GU280_gp10 N 29366 1093C>T missense_variant P365S Pro365Ser
V5651 BN.1.1.1 9.46e-1 GU280_gp10 N 29510 1237A>C missense_variant S413R Ser413Arg
V5758 BN.1.1.1 1.46e-1 GU280_gp02 S 29733 *4350_*4375delGAGGCCACGCGGAGTACGATCGAGTG downstream_gene_variant None None
V5801 BN.1.1.1 4.12e-2 GU280_gp02 S 29762 *4378C>T downstream_gene_variant None None
V1066 BN.1.1.1 9.96e-1 GU280_gp01_pp1a ORF1ab_pp1a 3927 3662C>T missense_variant S1221L Ser1221Leu
V1114 BN.1.1.1 1.00e+0 GU280_gp01_pp1a ORF1ab_pp1a 4184 3919G>A missense_variant G1307S Gly1307Ser
V6 BN.1.1.1 2.06e-2 GU280_gp01_pp1a ORF1ab_pp1a 44 -222C>T upstream_gene_variant None None
V1262 BN.1.1.1 9.98e-1 GU280_gp01_pp1a ORF1ab_pp1a 5183 4918C>T missense_variant P1640S Pro1640Ser
V2420 BN.1.1.1 1.24e-2 GU280_gp01_pp1a ORF1ab_pp1a 13170 12905C>T missense_variant T4302I Thr4302Ile
V249 BN.1.1.1 9.81e-1 GU280_gp01_pp1a ORF1ab_pp1a 670 405T>G missense_variant S135R Ser135Arg
V260 BN.1.1.1 1.03e-2 GU280_gp01_pp1a ORF1ab_pp1a 685 421_429delAAGTCATTT conservative_inframe_deletion K141_F143del Lys141_Phe143del
V1670 BN.1.1.1 3.92e-2 GU280_gp01_pp1a ORF1ab_pp1a 7764 7499C>T missense_variant S2500F Ser2500Phe
V1780 BN.1.1.1 1.86e-2 GU280_gp01_pp1a ORF1ab_pp1a 8480 8215C>T missense_variant P2739S Pro2739Ser
V1907 BN.1.1.1 9.90e-1 GU280_gp01_pp1a ORF1ab_pp1a 9344 9079C>T missense_variant L3027F Leu3027Phe
V1937 BN.1.1.1 9.53e-1 GU280_gp01_pp1a ORF1ab_pp1a 9534 9269C>T missense_variant T3090I Thr3090Ile
V1969 BN.1.1.1 9.77e-1 GU280_gp01_pp1a ORF1ab_pp1a 9866 9601C>T missense_variant L3201F Leu3201Phe
V2037 BN.1.1.1 9.94e-1 GU280_gp01_pp1a ORF1ab_pp1a 10449 10184C>A missense_variant P3395H Pro3395His
V2522 BN.1.1.1 3.30e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 13923 13659C>A missense_variant D4553E Asp4553Glu
V6265 BN.1.1.1 9.92e-1 GU280_gp01_pp1a ORF1ab_pp1a 3037 2772C>T synonymous_variant F924F Phe924Phe
V6364 BN.1.1.1 9.90e-1 GU280_gp01_pp1a ORF1ab_pp1a 3796 3531C>T synonymous_variant V1177V Val1177Val
V6426 BN.1.1.1 9.51e-1 GU280_gp01_pp1a ORF1ab_pp1a 4321 4056C>T synonymous_variant A1352A Ala1352Ala
V6463 BN.1.1.1 9.13e-1 GU280_gp01_pp1a ORF1ab_pp1a 4586 4321C>T synonymous_variant L1441L Leu1441Leu
V7082 BN.1.1.1 9.84e-1 GU280_gp01_pp1a ORF1ab_pp1a 9424 9159A>G synonymous_variant V3053V Val3053Val
V7193 BN.1.1.1 9.69e-1 GU280_gp01_pp1a ORF1ab_pp1a 10198 9933C>T synonymous_variant D3311D Asp3311Asp
V7219 BN.1.1.1 9.92e-1 GU280_gp01_pp1a ORF1ab_pp1a 10447 10182G>A synonymous_variant R3394R Arg3394Arg
V7520 BN.1.1.1 9.94e-1 GU280_gp01_pp1a ORF1ab_pp1a 12880 12615C>T synonymous_variant I4205I Ile4205Ile
V7888 BN.1.1.1 9.98e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 15714 15450C>T synonymous_variant L5150L Leu5150Leu
V7964 BN.1.1.1 1.32e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 16308 16044C>T synonymous_variant F5348F Phe5348Phe
V8470 BN.1.1.1 8.82e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 20235 19971C>T synonymous_variant P6657P Pro6657Pro
V8923 BN.1.1.1 6.60e-2 GU280_gp02 S 23854 2292C>T synonymous_variant N764N Asn764Asn
V9076 BN.1.1.1 9.96e-1 GU280_gp02 S 25000 3438C>T synonymous_variant D1146D Asp1146Asp
V9139 BN.1.1.1 1.00e+0 GU280_gp03 ORF3a 25416 24C>T synonymous_variant F8F Phe8Phe
V9171 BN.1.1.1 1.00e+0 GU280_gp03 ORF3a 25584 192C>T synonymous_variant T64T Thr64Thr
V9334 BN.1.1.1 9.01e-1 GU280_gp05 M 26858 336C>T synonymous_variant F112F Phe112Phe
V9401 BN.1.1.1 9.55e-1 GU280_gp06 ORF6 27259 58A>C synonymous_variant R20R Arg20Arg
V9418 BN.1.1.1 9.79e-1 GU280_gp06 ORF6 27384 183T>C synonymous_variant D61D Asp61Asp
V9496 BN.1.1.1 9.92e-1 GU280_gp08 ORF7b 27807 52C>T synonymous_variant L18L Leu18Leu
V9620 BN.1.1.1 9.03e-1 GU280_gp10 N 28585 312C>T synonymous_variant L104L Leu104Leu
V9682 BN.1.1.1 9.81e-1 GU280_gp10 N 28882 609G>A synonymous_variant R203R Arg203Arg
V6890 BN.1.1.1 3.30e-2 GU280_gp01_pp1a ORF1ab_pp1a 7936 7671G>T synonymous_variant A2557A Ala2557Ala
V9519 BN.1.1.1 3.09e-2 GU280_gp09 ORF8 27995 102T>C synonymous_variant D34D Asp34Asp
V7371 BN.1.1.1 3.71e-2 GU280_gp01_pp1a ORF1ab_pp1a 11758 11493C>T synonymous_variant P3831P Pro3831Pro
V8457 BN.1.1.1 7.65e-1 GU280_gp01_pp1ab ORF1ab_pp1ab 20055 19791A>G synonymous_variant E6597E Glu6597Glu
V7843 BN.1.1.1 1.24e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15360 15096C>T synonymous_variant R5032R Arg5032Arg
V9517 BN.1.1.1 1.24e-2 GU280_gp09 ORF8 27983 90A>T synonymous_variant P30P Pro30Pro
V5970 BN.1.1.1 4.74e-2 GU280_gp01_pp1a ORF1ab_pp1a 991 726G>T synonymous_variant T242T Thr242Thr
V8225 BN.1.1.1 6.60e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 18303 18039C>T synonymous_variant G6013G Gly6013Gly
V8781 BN.1.1.1 3.30e-2 GU280_gp02 S 22744 1182T>C synonymous_variant N394N Asn394Asn
V9485 BN.1.1.1 3.09e-2 GU280_gp07 ORF7a 27741 348C>T synonymous_variant L116L Leu116Leu
V8292 BN.1.1.1 3.09e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 18744 18480C>T synonymous_variant Y6160Y Tyr6160Tyr
V8786 BN.1.1.1 1.24e-2 GU280_gp02 S 22792 1230C>T synonymous_variant I410I Ile410Ile
V9576 BN.1.1.1 6.19e-2 GU280_gp10 N 28363 90A>T synonymous_variant G30G Gly30Gly
V9095 BN.1.1.1 1.44e-2 GU280_gp02 S 25096 3534C>T synonymous_variant N1178N Asn1178Asn
V9542 BN.1.1.1 1.44e-2 GU280_gp09 ORF8 28154 261A>G synonymous_variant T87T Thr87Thr
V8380 BN.1.1.1 2.68e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 19386 19122C>T synonymous_variant D6374D Asp6374Asp
V7531 BN.1.1.1 1.03e-2 GU280_gp01_pp1a ORF1ab_pp1a 12970 12705C>T synonymous_variant N4235N Asn4235Asn
V9344 BN.1.1.1 1.03e-2 GU280_gp05 M 26891 369A>G synonymous_variant P123P Pro123Pro
V9086 BN.1.1.1 1.65e-2 GU280_gp02 S 25048 3486A>T synonymous_variant P1162P Pro1162Pro
V9204 BN.1.1.1 1.24e-2 GU280_gp03 ORF3a 25803 411C>T synonymous_variant N137N Asn137Asn
V9800 BN.1.1.1 1.65e-2 GU280_gp10 N 29440 1167G>A synonymous_variant Q389Q Gln389Gln
V6636 BN.1.1.1 1.86e-2 GU280_gp01_pp1a ORF1ab_pp1a 5869 5604C>T synonymous_variant Y1868Y Tyr1868Tyr
V7089 BN.1.1.1 1.24e-2 GU280_gp01_pp1a ORF1ab_pp1a 9451 9186C>T synonymous_variant Y3062Y Tyr3062Tyr
V8416 BN.1.1.1 1.86e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 19704 19440T>C synonymous_variant N6480N Asn6480Asn
V9465 BN.1.1.1 1.03e-2 GU280_gp07 ORF7a 27636 243A>G synonymous_variant S81S Ser81Ser
V8161 BN.1.1.1 1.24e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 17766 17502C>T synonymous_variant V5834V Val5834Val
V7925 BN.1.1.1 1.03e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15960 15696C>T synonymous_variant A5232A Ala5232Ala
V7176 BN.1.1.1 1.24e-2 GU280_gp01_pp1a ORF1ab_pp1a 10078 9813C>T synonymous_variant F3271F Phe3271Phe
V9340 BN.1.1.1 2.68e-2 GU280_gp05 M 26882 360C>T synonymous_variant L120L Leu120Leu
V7817 BN.1.1.1 1.03e-2 GU280_gp01_pp1ab ORF1ab_pp1ab 15120 14856C>T synonymous_variant V4952V Val4952Val
V9316 BN.1.1.1 3.09e-2 GU280_gp05 M 26753 231C>T synonymous_variant T77T Thr77Thr
V9534 BN.1.1.1 2.47e-2 GU280_gp09 ORF8 28094 201T>C synonymous_variant S67S Ser67Ser
V9391 BN.1.1.1 1.03e-2 GU280_gp05 M 27143 621C>T synonymous_variant N207N Asn207Asn
V6461 BN.1.1.1 2.47e-2 GU280_gp01_pp1a ORF1ab_pp1a 4582 4317C>T synonymous_variant N1439N Asn1439Asn
V9366 BN.1.1.1 1.24e-2 GU280_gp05 M 26988 466C>T synonymous_variant L156L Leu156Leu
V6080 BN.1.1.1 1.03e-2 GU280_gp01_pp1a ORF1ab_pp1a 1825 1560C>T synonymous_variant A520A Ala520Ala